circad | circRNAs associated with diseases

CircARSP91/hsa_circ_0085154
Gene	PABPC1	Organism	Human
Genome Locus	chr8:101721360-101721451:-	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	29144509
Experimental Method
Sample Type	MHCC-97h, LM3 and LO2 cells	Comparison	Hepatocellular Cancer tumor tissues compared with adjacent normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGTGCCAGACCTCATCACTC Reverse GAGCAGTCCAGCGAGGACTT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Shi, L, Yan, P, Liang, Y, Sun, Y, Shen, J, Zhou, S, Lin, H, Liang, X, Cai, X (2017). Circular RNA expression is suppressed by androgen receptor (AR)-regulated adenosine deaminase that acts on RNA (ADAR1) in human hepatocellular carcinoma. Cell Death Dis, 8, 11:e3171.